SLC7A1 (1 of 2)

Ensembl ID:
ENSDARG00000041874
Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Source:HGNC Symbol;A
Human Orthologue:
SLC7A1
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a1
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22589 Nonsense Available for shipment Available now
sa9799 Nonsense Available for shipment Available now
sa17253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034376 Nonsense 307 637 6 12
Genomic Location (Zv9):
Chromosome 15 (position 7242280)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7318150
GRCz11 15 7314638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCATTGTAGCCTCTCTCCTCATCTGTTTCGTCGCTTATTTCGGTGTTT[C/A]GGCTGCACTGACGATGATGATGCCGTACTACATGCTGGACAAAAACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034376 Nonsense 334 637 6 12
Genomic Location (Zv9):
Chromosome 15 (position 7242199)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7318069
GRCz11 15 7314557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTGGACAAAAACAGTCCTCTGCCTGTGGCCTTCAAATATGTGRGCT[G/A]GGAAGGAGCGACGTACGCTGTAGCCGTTGGCTCTCTTTGTGCTTTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034376 Nonsense 534 637 10 12
Genomic Location (Zv9):
Chromosome 15 (position 7236475)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7312044
GRCz11 15 7308841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCAAACTTGGACTCTTGCAGTTCTTATCTCTCTGGCTTTAGTTTGCT[T/A]GATCATCACCTTGTTAATATGGCGGCAGCCKGAGAGCAAGACAAAACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link