ift172

Ensembl ID:
ENSDARG00000041870
ZFIN ID:
ZDB-GENE-040827-1
Description:
Intraflagellar transport protein 172 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5RHH4]
Human Orthologue:
IFT172
Human Description:
intraflagellar transport 172 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:30391]
Mouse Orthologue:
Ift172
Mouse Description:
intraflagellar transport 172 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:2682064]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44947 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061334 Essential Splice Site 1404 1745 38 48
Genomic Location (Zv9):
Chromosome 20 (position 38908780)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38981192
GRCz11 20 38884071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAAACGCTACAAAGAGCACCTGAAAAATCAAGGCAAAGTTGACTCTG[T/C]AAGTTACCTTTGTTAATCTTCTAACTGCCACTAGAGAGAATAAAAAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link