
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
capn3
- Ensembl ID:
- ENSDARG00000041864
- ZFIN ID:
- ZDB-GENE-040912-97
- Description:
- calpain-3 [Source:RefSeq peptide;Acc:NP_001004571]
- Human Orthologue:
- CAPN3
- Human Description:
- calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
- Mouse Orthologue:
- Capn3
- Mouse Description:
- calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36511 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23173 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa36511
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103468 | Nonsense | 3 | 725 | 1 | 21 |
- Genomic Location (Zv9):
- Chromosome 17 (position 45472738)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 45191920 GRCz11 17 45305685 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGGTGTTTTCAATCCCTTAAAAAAAAAACAGTGAGACAAGATGCCCTA[T/A]ACGCCGTCTGGGTTCTTCTGCGACCGTTTAATTCGGGAGAGGGAGAGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23173
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103468 | Essential Splice Site | 445 | 725 | 11 | 21 |
- Genomic Location (Zv9):
- Chromosome 17 (position 45495584)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 45344816 GRCz11 17 45328068 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATAATACAACCATATTCCATCCCATTTAATTCTTCCCTTTTTTCCGTA[G/A]GTGCCAAAGGAGGTATGAAAATGTTAAGAAGACTGTTTGGACCCAAGGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: