zgc:123170

Ensembl ID:
ENSDARG00000041830
ZFIN ID:
ZDB-GENE-030131-6039
Description:
translin [Source:RefSeq peptide;Acc:NP_001020623]
Human Orthologue:
TSN
Human Description:
translin [Source:HGNC Symbol;Acc:12379]
Mouse Orthologue:
Tsn
Mouse Description:
translin Gene [Source:MGI Symbol;Acc:MGI:109263]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061299 Nonsense 215 227 6 6
Genomic Location (Zv9):
Chromosome 9 (position 23971372)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23127158
GRCz11 9 22938027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGTACGACGTGAAAAAGATCGAGGAGGTGGTGTACGATCTCTCCATC[C/T]GAGGCCTCGCCAAGGAGCAGGAGGCAGGAGAAGAGAAGTAGAGTTGTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link