
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cx43
- Ensembl ID:
- ENSDARG00000041799
- ZFIN ID:
- ZDB-GENE-991105-4
- Description:
- Gap junction alpha-1 protein [Source:UniProtKB/Swiss-Prot;Acc:O57474]
- Human Orthologue:
- GJA1
- Human Description:
- gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
- Mouse Orthologues:
- Gja1, Gja6
- Mouse Descriptions:
- gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
- gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32313 | Nonsense | Available for shipment | Available now |
sa29432 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37126 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32313
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047272 | None | 282 | 2 | 3 | |
ENSDART00000061261 | Nonsense | 7 | 381 | 2 | 2 |
ENSDART00000138569 | Nonsense | 7 | 341 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 20 (position 40749612)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 40820771 GRCz11 20 40717881 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTTCTATTTTCAGCTAGAACTCCCTCAAGATGGGTGACTGGAGTGCGT[T/A]GGGAAGGCTTCTTGACAAGGTGCAGGCCTACTCCACGGCCGGAGGGAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29432
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047272 | None | 282 | 3 | 3 | |
ENSDART00000061261 | Nonsense | 68 | 381 | 2 | 2 |
ENSDART00000138569 | Nonsense | 28 | 341 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 20 (position 40749430)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 40820589 GRCz11 20 40717699 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTCAAGTGCAATACCCAGCAGCCTGGTTGCGAGAATGTCTGCTATGAC[A/T]AATCGTTCCCCATCTCGCACGTGCGCTTCTGGGTGCTTCAGATCATCTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37126
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047272 | Nonsense | 144 | 282 | 3 | 3 |
ENSDART00000061261 | Nonsense | 243 | 381 | 2 | 2 |
ENSDART00000138569 | Nonsense | 203 | 341 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 20 (position 40748905)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 40820064 GRCz11 20 40717174 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGAGCTCTTCTACGTGCTCTTCAAACGAATCAAGGACCGCGTCAAAAGC[C/T]GACAAAACACACAGTTTCCCACTGGCACTTTGAGCCCCACGCCGAAGGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
- Resting heart rate: Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: a genome-wide association study of 13,372 participants. (View Study)
- Resting heart rate: Genome-wide association analysis identifies multiple loci related to resting heart rate. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: