si:dkey-72g4.2

Ensembl ID:
ENSDARG00000041779
ZFIN ID:
ZDB-GENE-041014-193
Description:
Si:dkey-72g4.2 protein [Source:UniProtKB/TrEMBL;Acc:Q5XJD2]
Human Orthologue:
TRDN
Human Description:
triadin [Source:HGNC Symbol;Acc:12261]
Mouse Orthologue:
Trdn
Mouse Description:
triadin Gene [Source:MGI Symbol;Acc:MGI:1924007]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6647 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15309 Essential Splice Site Available for shipment Available now
sa10815 Essential Splice Site Available for shipment Available now
sa10783 Essential Splice Site Available for shipment Available now
sa11135 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061233 Essential Splice Site 71 536 2 9
ENSDART00000101041 Essential Splice Site 74 785 2 23
ENSDART00000109681 Essential Splice Site 74 142 2 5
ENSDART00000121818 Essential Splice Site 71 534 2 11
ENSDART00000131119 Essential Splice Site 71 348 1 11
ENSDART00000143680 Essential Splice Site 74 90 2 4
Genomic Location (Zv9):
Chromosome 20 (position 40186319)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40257581
GRCz11 20 40160217
KASP Assay ID:
554-5337.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGTGGCCATCATTATGTTTGACCTRCTCGACAGCAAGGGTCTTGAAG[G/A]TAGGTCCAGCTCTCTTATCATTGCCTAATTCACTTCGATGGGGAGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061233 Essential Splice Site 140 536 5 9
ENSDART00000101041 Essential Splice Site 143 785 5 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 140 534 5 11
ENSDART00000131119 Essential Splice Site 140 348 4 11
ENSDART00000143680   None 90 None 4
Genomic Location (Zv9):
Chromosome 20 (position 40214487)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40285749
GRCz11 20 40188385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTYCTCCTYCACCAATTTAGGCGAGCGTCATTTTGTGAAGAAAAAAG[G/A]TTAGTATCAAANNCTGTCCTCCTTCAYTTTCATTATACACAAATAWGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
Genomic Location (Zv9):
Chromosome 20 (position 40228754)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40300016
GRCz11 20 40202652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARGAAGAGGAGGAGGAGCTTGAGGAAGAAGAGGAGGAGGAGCTTGAKGA[A/G]GAAGAGGAGGAGGAGCTTGAGRARGAAGAGGAGAAARAGCTTGAGGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
Genomic Location (Zv9):
Chromosome 20 (position 40228754)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40300016
GRCz11 20 40202652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARGAAGAGGAGGAGGAGCTTGAGGAAGAAGAGGAGGAGGAGCTTGAKGA[A/G]GAAGAGGAGGAGGAGCTTGAGRARGAAGAGGAGAAARAGCTTGAGGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
ENSDART00000061233   217 536 7 9
ENSDART00000101041   220 785 7 23
ENSDART00000109681   None 142 None 5
ENSDART00000121818 Essential Splice Site 210 534 None 11
ENSDART00000131119   None 348 None 11
ENSDART00000143680   None 90 None 4
Genomic Location (Zv9):
Chromosome 20 (position 40228754)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40300016
GRCz11 20 40202652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARGAAGAGGAGGAGGAGCTTGAGGAAGAAGAGGAGGAGGAGCTTGAKGA[A/G]GAAGAGGAGGAGGAGCTTGAGRARGAAGAGGAGAAARAGCTTGAGGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link