zgc:123269

Ensembl ID:
ENSDARG00000041750
ZFIN ID:
ZDB-GENE-051113-120
Description:
coiled-coil domain containing 92 [Source:RefSeq peptide;Acc:NP_001032794]
Human Orthologue:
CCDC92
Human Description:
coiled-coil domain containing 92 [Source:HGNC Symbol;Acc:29563]
Mouse Orthologue:
Ccdc92
Mouse Description:
coiled-coil domain containing 92 Gene [Source:MGI Symbol;Acc:MGI:106485]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10700 Essential Splice Site Available for shipment Available now
sa10236 Nonsense Available for shipment Available now
sa1368 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061196 Essential Splice Site 45 349 1 3
ENSDART00000134801 Essential Splice Site 45 349 2 4
Genomic Location (Zv9):
Chromosome 8 (position 45160532)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43113314
GRCz11 8 43120101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAAAGGCCTTCATTCTGAGATCCGCCGTCTGCAACAACACTGCACAG[G/A]TACACACACACACATTGACAGCACAACTGCATGAGGCAGCAYACCTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061196 Nonsense 203 349 3 3
ENSDART00000134801 Nonsense 203 349 4 4
Genomic Location (Zv9):
Chromosome 8 (position 45137794)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43090576
GRCz11 8 43097363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTCCGGCAACCTGAGACCCCTCGCAGGCGCATGCGCAAAAGTCTCTCA[C/T]AACCRCTACACTCCGAATACACGGAGCTCTACCGTATGGGCGCCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061196 Nonsense 311 349 3 3
ENSDART00000134801 Nonsense 311 349 4 4
Genomic Location (Zv9):
Chromosome 8 (position 45137469)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43090251
GRCz11 8 43097038
KASP Assay ID:
554-1280.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTCCCGAGCTAATGCACATATAGGAGTAGCGCATCGCATCCACCGCT[C/A]GCCCTCAGCAGGTGGAGGAGCAGCCCGGCAGCAGGCRGAGGTGGAGACCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link