
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:123269
- Ensembl ID:
- ENSDARG00000041750
- ZFIN ID:
- ZDB-GENE-051113-120
- Description:
- coiled-coil domain containing 92 [Source:RefSeq peptide;Acc:NP_001032794]
- Human Orthologue:
- CCDC92
- Human Description:
- coiled-coil domain containing 92 [Source:HGNC Symbol;Acc:29563]
- Mouse Orthologue:
- Ccdc92
- Mouse Description:
- coiled-coil domain containing 92 Gene [Source:MGI Symbol;Acc:MGI:106485]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10700 | Essential Splice Site | Available for shipment | Available now |
sa10236 | Nonsense | Available for shipment | Available now |
sa1368 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10700
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061196 | Essential Splice Site | 45 | 349 | 1 | 3 |
ENSDART00000134801 | Essential Splice Site | 45 | 349 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45160532)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43113314 GRCz11 8 43120101 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTGAAAGGCCTTCATTCTGAGATCCGCCGTCTGCAACAACACTGCACAG[G/A]TACACACACACACATTGACAGCACAACTGCATGAGGCAGCAYACCTACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10236
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061196 | Nonsense | 203 | 349 | 3 | 3 |
ENSDART00000134801 | Nonsense | 203 | 349 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45137794)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43090576 GRCz11 8 43097363 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGTCCGGCAACCTGAGACCCCTCGCAGGCGCATGCGCAAAAGTCTCTCA[C/T]AACCRCTACACTCCGAATACACGGAGCTCTACCGTATGGGCGCCACAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1368
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061196 | Nonsense | 311 | 349 | 3 | 3 |
ENSDART00000134801 | Nonsense | 311 | 349 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45137469)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43090251 GRCz11 8 43097038 - KASP Assay ID:
- 554-1280.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCATTCCCGAGCTAATGCACATATAGGAGTAGCGCATCGCATCCACCGCT[C/A]GCCCTCAGCAGGTGGAGGAGCAGCCCGGCAGCAGGCRGAGGTGGAGACCC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: