si:dkey-233p4.1

Ensembl ID:
ENSDARG00000041734
ZFIN ID:
ZDB-GENE-061106-5
Description:
Protein broad-minded [Source:UniProtKB/Swiss-Prot;Acc:Q5RHR6]
Human Orthologue:
C6orf170
Human Description:
chromosome 6 open reading frame 170 [Source:HGNC Symbol;Acc:21485]
Mouse Orthologue:
D630037F22Rik
Mouse Description:
RIKEN cDNA D630037F22 gene Gene [Source:MGI Symbol;Acc:MGI:2442827]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45715 Nonsense Mutation detected in F1 DNA During 2018
sa43510 Nonsense Mutation detected in F1 DNA During 2018
sa29433 Nonsense Mutation detected in F1 DNA During 2018
sa16562 Nonsense Available for shipment Available now
sa16300 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061168 Nonsense 322 1298 9 33
ENSDART00000144401 Nonsense 322 1298 10 34
Genomic Location (Zv9):
Chromosome 20 (position 40809307)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40880466
GRCz11 20 40777576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAATGAGTTTTTTTGTCCTGTGCTCTAGGTACATGGAAGAAATCATT[G/T]AAAACACCCTGTCTCTTCTCGCTCTGCATTCTGAACAGGGCATGAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061168 Nonsense 409 1298 11 33
ENSDART00000144401 Nonsense 409 1298 12 34
Genomic Location (Zv9):
Chromosome 20 (position 40812037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40883196
GRCz11 20 40780306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCATTTATTACTTTGATTCCTGTGATGCATTAAGTGAAGAGACCTTG[G/T]AAATGATCCACAGCCTGGAACATCAGCAGATTGGTACGGCTGAACTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061168 Nonsense 852 1298 22 33
ENSDART00000144401 Nonsense 852 1298 23 34
Genomic Location (Zv9):
Chromosome 20 (position 40825202)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40896361
GRCz11 20 40793471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTCATCATTATTAACTCTGACGCGAAGATTCACTCTCTTTTCAACTA[T/A]GAACAGTCCCACACGTTTGGCCTGAGGTAAGATCAATAGTTCAGTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061168 Nonsense 957 1298 25 33
ENSDART00000144401 Nonsense 957 1298 26 34
Genomic Location (Zv9):
Chromosome 20 (position 40841636)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40912795
GRCz11 20 40809905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCCTTACCCATGGCCAATGGTGWCCACTTATCCTCTGCCWAAGTATTA[T/A]ATATTCGACGTGCCCAAGATTCTCCGCACYAAACAGGGTAAGAACTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061168 Nonsense 1188 1298 31 33
ENSDART00000144401 Nonsense 1188 1298 32 34
Genomic Location (Zv9):
Chromosome 20 (position 40854919)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40926078
GRCz11 20 40823188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGTAGAGATGTTGCTCAAGGCTGAGGTTCCTCTGGTKTTTTCTGCCTTC[A/T]GAATGTCWGGCTTYACTCCMTCTCAGGTGCAATATTTTAAGTAYTTMATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link