zgc:92432

Ensembl ID:
ENSDARG00000041729
ZFIN IDs:
ZDB-GENE-040704-13, ZDB-GENE-040704-13
Description:
beta-1-syntrophin [Source:RefSeq peptide;Acc:NP_001002175]
Human Orthologue:
SNTB1
Human Description:
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) [Source:HGNC Symbol;
Mouse Orthologue:
Sntb1
Mouse Description:
syntrophin, basic 1 Gene [Source:MGI Symbol;Acc:MGI:101781]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36075 Nonsense Mutation detected in F1 DNA During 2018
sa45569 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16267 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061164 Nonsense 76 515 1 8
ENSDART00000125691 Nonsense 76 515 1 7
Genomic Location (Zv9):
Chromosome 16 (position 17558078)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15372648
GRCz11 16 15262768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACCGGACCCCACCAACAGTCCCAAAACCGGAGCGAGAACTCCTTTTT[C/A]GGATTCACAAGTGCCCGAAGCGATTGCGAACCGCAAGAGATGCGTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061164 Essential Splice Site 241 515 2 8
ENSDART00000125691 Essential Splice Site 241 515 2 7
Genomic Location (Zv9):
Chromosome 16 (position 17537373)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15351943
GRCz11 16 15242063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTGCTACATCACACGCAGTATGACTGTGCCTGACCCAGAAAACAG[G/A]TACAGCTGCTTTTGGATATAGTATCCGTTTGTTAAGGCCCAATCCCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061164 Essential Splice Site 241 515 3 8
ENSDART00000125691 Essential Splice Site 241 515 3 7
Genomic Location (Zv9):
Chromosome 16 (position 17510419)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 15324989
GRCz11 16 15215109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTAATTCAACCAGAAGGTTAATNATGTTTCTTTTCTGTCATTGTGTTTC[A/T]GACAGGTGGAGCTGCACTCCTCTGATGCTAAAAACACAATAGTGATGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link