
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-174k18.8
- Ensembl ID:
- ENSDARG00000041728
- ZFIN IDs:
- ZDB-GENE-030131-7478, ZDB-GENE-030131-7478, ZDB-GENE-070912-390
- Description:
- Novel protein similar to vertebrate mannosidase, alpha, class 1A, member 2 (MAN1A2) [Source:UniProtK
- Human Orthologue:
- MAN1A2
- Human Description:
- mannosidase, alpha, class 1A, member 2 [Source:HGNC Symbol;Acc:6822]
- Mouse Orthologue:
- Man1a2
- Mouse Description:
- mannosidase, alpha, class 1A, member 2 Gene [Source:MGI Symbol;Acc:MGI:104676]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2510 | Essential Splice Site | F2 line generated | During 2018 |
sa15063 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2510
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102192 | Essential Splice Site | 104 | 645 | 1 | 13 |
ENSDART00000144248 | Essential Splice Site | 104 | 645 | 2 | 14 |
ENSDART00000147435 | Essential Splice Site | 104 | 106 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 9 (position 21591610)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 20747396 GRCz11 9 20558265 - KASP Assay ID:
- 554-3167.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTAGACAGGTCATACATGGTGTGGGAGCTCAYGACGAGCATCGGCACAG[G/A]TAAGAGCTTCAGATTCTCAAACACAACATGCGTTTTCATGTTTAAGTATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15063
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102192 | Essential Splice Site | 262 | 645 | 4 | 13 |
ENSDART00000144248 | Essential Splice Site | 262 | 645 | 5 | 14 |
ENSDART00000147435 | None | 106 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 9 (position 21733516)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 20889302 GRCz11 9 20700171 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTAAAGAYGGCCAGGAGTGGATCGAGCAAAACCTGGATTTCAGTGTGG[T/G]AAGTGGCCAAGACACACACAACAACCACCANNNNNNNNACACTTCTCTTTGTAGGTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: