zgc:55461

Ensembl ID:
ENSDARG00000041723
ZFIN IDs:
ZDB-GENE-040426-2879, ZDB-GENE-051127-13, ZDB-GENE-060929-568
Description:
tubulin, beta 2B [Source:RefSeq peptide;Acc:NP_998655]
Human Orthologue:
TUBB4
Human Description:
tubulin, beta 4 [Source:HGNC Symbol;Acc:20774]
Mouse Orthologue:
Tubb4
Mouse Description:
tubulin, beta 4 Gene [Source:MGI Symbol;Acc:MGI:107848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061149 Nonsense 423 445 4 4
Genomic Location (Zv9):
Chromosome 5 (position 34636889)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32418838
GRCz11 5 33018991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTTCACTGAGGCCGAGAGCAACATGAATGACCTGGTGTCCGAGTAC[C/T]AGCAGTACCAAGATGCCACTGCGGAAGAAGAGGGAGAGTTTGAGGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link