vgll2a

Ensembl ID:
ENSDARG00000041706
ZFIN ID:
ZDB-GENE-050913-38
Description:
transcription cofactor vestigial-like protein 2 [Source:RefSeq peptide;Acc:NP_001020657]
Human Orthologue:
VGLL2
Human Description:
vestigial like 2 (Drosophila) [Source:HGNC Symbol;Acc:20232]
Mouse Orthologue:
Vgll2
Mouse Description:
vestigial like 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2447460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1809 Missense F2 line generated During 2018

Mutation Details

Allele Name:
sa1809
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061049 Missense 198 296 3 4
ENSDART00000144905 Missense 198 295 3 4
Genomic Location (Zv9):
Chromosome 20 (position 42467417)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42538576
GRCz11 20 42435686
KASP Assay ID:
554-1801.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACCACCCCAGAGCCGTGGCACCCGTCCCACCACCATCACCCGTACT[C/T]GCTCAGCGGAGCCATCGGCACCCAAGGGTCCACTTACCCCCGGCCCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link