
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bhlhe41
- Ensembl ID:
- ENSDARG00000041691
- ZFIN ID:
- ZDB-GENE-050419-146
- Description:
- class E basic helix-loop-helix protein 41 [Source:RefSeq peptide;Acc:NP_001034196]
- Human Orthologue:
- BHLHE41
- Human Description:
- basic helix-loop-helix family, member e41 [Source:HGNC Symbol;Acc:16617]
- Mouse Orthologue:
- Bhlhe41
- Mouse Description:
- basic helix-loop-helix family, member e41 Gene [Source:MGI Symbol;Acc:MGI:1930704]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2955 | Essential Splice Site | F2 line generated | During 2018 |
sa10095 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2955
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061106 | Essential Splice Site | 42 | 421 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 15785352)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 16137118 GRCz11 18 16126184 - KASP Assay ID:
- 554-2706.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTCTACATGTGCAAATCCAAAAGGGGGATGAAGAGAGAGGAAGGAAAGG[T/A]AAGCAAACTGTGGACCCGTGATGAAAACGTGACATTCACGTAACACTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10095
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061106 | Nonsense | 328 | 421 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 15787257)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 16139023 GRCz11 18 16128089 - KASP Assay ID:
- 2261-2011.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCATCATACATGCCTTTATTTGACAAAAGTCATTTGGAGAAGTTGGTGTA[T/A]CCAGCAGCAGCGGCGGCGGCATTGACCACACCATTTCCATGGCTTTACCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: