Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
usf1
- Ensembl ID:
- ENSDARG00000041689
- ZFIN ID:
- ZDB-GENE-040426-1072
- Description:
- upstream transcription factor 1 [Source:RefSeq peptide;Acc:NP_956590]
- Human Orthologue:
- USF1
- Human Description:
- upstream transcription factor 1 [Source:HGNC Symbol;Acc:12593]
- Mouse Orthologue:
- Usf1
- Mouse Description:
- upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa8978 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa10575 | Nonsense | Available for shipment | Available now |
| sa22630 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa8978
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000019636 | Essential Splice Site | 20 | 309 | 3 | 11 |
| ENSDART00000132373 | Essential Splice Site | 20 | 205 | 3 | 9 |
| ENSDART00000133821 | Essential Splice Site | 20 | 90 | 3 | 5 |
| ENSDART00000138676 | Essential Splice Site | 20 | 248 | 3 | 10 |
| ENSDART00000142070 | Essential Splice Site | 20 | 156 | 3 | 7 |
| ENSDART00000142902 | None | 230 | None | 7 | |
| ENSDART00000143643 | Essential Splice Site | 20 | 299 | 3 | 11 |
| ENSDART00000143990 | Essential Splice Site | 20 | 213 | 3 | 9 |
| ENSDART00000144901 | Essential Splice Site | 20 | 224 | 3 | 9 |
| ENSDART00000146967 | Essential Splice Site | 20 | 237 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 20214934)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 21317560 GRCz11 15 21253292 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAACCGAAAAGTTCTGARCCTGATGTCAGTRTTCCAGTCATTGAAGAAGG[T/C]ATTATCAGGTTACTTGTAAAGCAGCATTATGAGTTTTTTAAAATATATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10575
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000019636 | Nonsense | 254 | 309 | 10 | 11 |
| ENSDART00000132373 | None | 205 | None | 9 | |
| ENSDART00000133821 | None | 90 | None | 5 | |
| ENSDART00000138676 | Nonsense | 242 | 248 | 10 | 10 |
| ENSDART00000142070 | None | 156 | None | 7 | |
| ENSDART00000142902 | Nonsense | 175 | 230 | 6 | 7 |
| ENSDART00000143643 | Nonsense | 244 | 299 | 10 | 11 |
| ENSDART00000143990 | None | 213 | None | 9 | |
| ENSDART00000144901 | None | 224 | None | 9 | |
| ENSDART00000146967 | None | 237 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 20220145)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 21322771 GRCz11 15 21258503 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGTAAAGGTGGGATCCTATCAAAGGCCTGTGATTACATTCAAGAGCTT[C/T]GACAAAGTAAYAGCCGGTTAGGAGATGAGCTGAACAGCATTGAGAGGTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22630
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000019636 | Nonsense | 275 | 309 | 10 | 11 |
| ENSDART00000132373 | None | 205 | None | 9 | |
| ENSDART00000133821 | None | 90 | None | 5 | |
| ENSDART00000138676 | None | 248 | 10 | 10 | |
| ENSDART00000142070 | None | 156 | None | 7 | |
| ENSDART00000142902 | Nonsense | 196 | 230 | 6 | 7 |
| ENSDART00000143643 | Nonsense | 265 | 299 | 10 | 11 |
| ENSDART00000143990 | None | 213 | None | 9 | |
| ENSDART00000144901 | None | 224 | None | 9 | |
| ENSDART00000146967 | None | 237 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 20220208)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 21322834 GRCz11 15 21258566 - KASP Assay ID:
- 2260-8397.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGGTTAGGAGATGAGCTGAACAGCATTGAGAGGTTGAGGATGGATAAC[C/T]AGCTGTTACGACAAGAGGTATTTTATTGGATTCAGTGACAAACTAAATTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
