mkrn1

Ensembl ID:
ENSDARG00000041665
ZFIN ID:
ZDB-GENE-020213-1
Description:
Probable E3 ubiquitin-protein ligase makorin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q4VBT5]
Human Orthologues:
MKRN1, MKRN3
Human Descriptions:
makorin ring finger protein 1 [Source:HGNC Symbol;Acc:7112]
makorin ring finger protein 3 [Source:HGNC Symbol;Acc:7114]
Mouse Orthologues:
Mkrn1, Mkrn3
Mouse Descriptions:
makorin, ring finger protein, 1 Gene [Source:MGI Symbol;Acc:MGI:1859353]
makorin, ring finger protein, 3 Gene [Source:MGI Symbol;Acc:MGI:2181178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45169 Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061070 Splice Site None 439 None 8

The following transcripts of ENSDARG00000041665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11357772)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12294399
GRCz11 4 12293248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGTTCTTCCAAAAGGGATGCTGTGCTTTCGGGGACCGTTGCAGGTA[T/A]GAGACACAATGATGTAATGTGTTGCATTATAATGTGCACCAAAACATCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link