
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bbs2
- Ensembl ID:
- ENSDARG00000041621
- ZFIN ID:
- ZDB-GENE-020801-1
- Description:
- Bardet-Biedl syndrome 2 protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q98SP7]
- Human Orthologue:
- BBS2
- Human Description:
- Bardet-Biedl syndrome 2 [Source:HGNC Symbol;Acc:967]
- Mouse Orthologue:
- Bbs2
- Mouse Description:
- Bardet-Biedl syndrome 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2135267]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa172 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa2952 | Nonsense | Available for shipment | Available now |
sa248 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa172
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061000 | Nonsense | 48 | 715 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 18 (position 17188405)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 17540171 GRCz11 18 17529237 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTTTTTATTTTTAAACCTATCCAGGTGTTTATCCACAACCCTCACACT[C/T]GAGCCCAGAGACCAACAGCCCACCGGTTGAGTCAAAGCACCCAGGACTCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2952
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061000 | Nonsense | 353 | 715 | 10 | 18 |
ENSDART00000061000 | Nonsense | 353 | 715 | 10 | 18 |
- Genomic Location (Zv9):
- Chromosome 18 (position 17183870)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 17535636 GRCz11 18 17524702 - KASP Assay ID:
- 554-2602.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCTGATCAGAGAGCTGAGTCAACGGAAACAGAACTTGATGCTYGAGTTR[C/T]GAAACTATGAGGAAAATGCCAAGGTTAGACATGCTATTCAAGTGATSCAT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa248
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061000 | Nonsense | 353 | 715 | 10 | 18 |
ENSDART00000061000 | Nonsense | 353 | 715 | 10 | 18 |
- Genomic Location (Zv9):
- Chromosome 18 (position 17183870)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 17535636 GRCz11 18 17524702 - KASP Assay ID:
- 554-2602.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCTGATCAGAGAGCTGAGTCAACGGAAACAGAACTTGATGCTYGAGTTR[C/T]GAAACTATGAGGAAAATGCCAAGGTTAGACATGCTATTCAAGTGATSCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: