
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eif4ebp3l
- Ensembl ID:
- ENSDARG00000041607
- ZFIN ID:
- ZDB-GENE-030826-26
- Description:
- Eukaryotic translation initiation factor 4E-binding protein 3-like [Source:UniProtKB/Swiss-Prot;Acc:
- Human Orthologues:
- EIF4EBP1, EIF4EBP2, EIF4EBP3
- Human Descriptions:
- eukaryotic translation initiation factor 4E binding protein 1 [Source:HGNC Symbol;Acc:3288]
- eukaryotic translation initiation factor 4E binding protein 2 [Source:HGNC Symbol;Acc:3289]
- eukaryotic translation initiation factor 4E binding protein 3 [Source:HGNC Symbol;Acc:3290]
- Mouse Orthologues:
- Eif4ebp1, Eif4ebp2, Eif4ebp3
- Mouse Descriptions:
- eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267
- eukaryotic translation initiation factor 4E binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:109198
- eukaryotic translation initiation factor 4E binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:127084
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22422 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22422
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060990 | Nonsense | 88 | 112 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 14 (position 6942036)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 6669004 GRCz11 14 6975731 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCCCAGATTCCAGGAGTGACCATTCCTTCACTCCACCCCGTGTCCAAAT[T/A]GCAGGAGCTCAAAGAGGAACTGGAGGAGGAGAAAGAGCTGGCAGGTAAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: