zgc:92335

Ensembl ID:
ENSDARG00000041602
ZFIN ID:
ZDB-GENE-040718-152
Description:
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria [Source:RefSeq peptide
Human Orthologue:
MMADHC
Human Description:
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria [Source:HGNC Symbol;Acc
Mouse Orthologue:
Mmadhc
Mouse Description:
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43791 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060979 Nonsense 21 291 3 8
ENSDART00000139826 Splice Site None 176 None 6
ENSDART00000140054 Splice Site None 271 None 8

The following transcripts of ENSDARG00000041602 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12736151)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12572081
GRCz11 22 12596858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTGCAGGAGGGTCAGGCAGGTGAGCCACTCGTCTGTCGTTCACTCTT[T/A]GGCTCAGAAAATTCTGGCAGTTCGAGCGTTTTCAGCCGCAGGGTCGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link