zgc:91860

Ensembl ID:
ENSDARG00000041599
ZFIN ID:
ZDB-GENE-040704-34
Description:
hypothetical protein LOC431740 [Source:RefSeq peptide;Acc:NP_001002193]
Human Orthologue:
KIAA0513
Human Description:
KIAA0513 [Source:HGNC Symbol;Acc:29058]
Mouse Orthologue:
6430548M08Rik
Mouse Description:
RIKEN cDNA 6430548M08 gene Gene [Source:MGI Symbol;Acc:MGI:2443793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43075 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010452 Nonsense 238 424 6 13
ENSDART00000100223 Nonsense 238 414 6 12
Genomic Location (Zv9):
Chromosome 18 (position 17106872)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17458638
GRCz11 18 17447704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGATCGACTCGTACCTGCGCAGTGGAAAGGTCTGGCTCTCTGGGAAG[A/T]AGGATATTGCAGAGCGGATGCTCAAAAACACCTCTGCTAAGACTGACGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link