adprhl1

Ensembl ID:
ENSDARG00000041589
ZFIN ID:
ZDB-GENE-041010-126
Description:
[Protein ADP-ribosylarginine] hydrolase-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJB9]
Human Orthologue:
ADPRHL1
Human Description:
ADP-ribosylhydrolase like 1 [Source:HGNC Symbol;Acc:21303]
Mouse Orthologue:
Adprhl1
Mouse Description:
ADP-ribosylhydrolase like 1 Gene [Source:MGI Symbol;Acc:MGI:2442168]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38234 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060968 Essential Splice Site 212 350 4 8
Genomic Location (Zv9):
Chromosome 1 (position 77491)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 207621
GRCz11 1 202800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCCCAAAGCAGAGGAGTACTGCAGGAAGACCATCCGCCACATGGCAG[G/A]TGACCCAGCCGCTCTGCTGACCCCCGCTGACCCCTCCAGATCATTAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link