wu:fb23g02

Ensembl ID:
ENSDARG00000041575
ZFIN IDs:
ZDB-GENE-030131-350, ZDB-GENE-030131-350, ZDB-GENE-030131-350, ZDB-GENE-041114-12
Description:
RNA (guanine-9-) methyltransferase domain containing 1 [Source:RefSeq peptide;Acc:NP_001007333]
Human Orthologue:
RG9MTD1
Human Description:
RNA (guanine-9-) methyltransferase domain containing 1 [Source:HGNC Symbol;Acc:26022]
Mouse Orthologue:
Rg9mtd1
Mouse Description:
RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1196261]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1936 Nonsense Available for shipment Available now
sa5931 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060954 Nonsense 124 403 2 4
ENSDART00000112581   None 292 None 5
ENSDART00000144606 Nonsense 124 403 3 5
ENSDART00000148162   None 292 None 5

The following transcripts of ENSDARG00000041575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 386371)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 516495
GRCz11 1 511674
KASP Assay ID:
554-1924.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAATCCTCCAAGAAGAAATACCTCAAATTCCTGGCCATCAAGGAGGCG[C/T]AGAAGAACAACGACAAGAGGAAGCAGGAGAAGAAGAGAGCTGAGAGAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa5931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060954 Nonsense 276 403 3 4
ENSDART00000112581 Nonsense 165 292 4 5
ENSDART00000144606 Nonsense 276 403 4 5
ENSDART00000148162 Nonsense 165 292 4 5

The following transcripts of ENSDARG00000041575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 384421)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 514545
GRCz11 1 509724
KASP Assay ID:
554-3683.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACVGAGCGCTCGCCGCTGGAGCTGTTCCCGCATCAGGACCTGGTGTA[C/A]CTCACWGCAGACTCGCGCTCCGTCCTGCGCACGTTCGACCACACCAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link