zfpm1

Ensembl ID:
ENSDARG00000041572
ZFIN ID:
ZDB-GENE-050419-238
Description:
Zinc finger protein FOG1 [Source:UniProtKB/Swiss-Prot;Acc:P60622]
Human Orthologue:
ZFPM1
Human Description:
zinc finger protein, multitype 1 [Source:HGNC Symbol;Acc:19762]
Mouse Orthologue:
Zfpm1
Mouse Description:
zinc finger protein, multitype 1 Gene [Source:MGI Symbol;Acc:MGI:1095400]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10486 Nonsense Available for shipment Available now
sa36619 Nonsense Mutation detected in F1 DNA During 2018
sa36618 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060949 Nonsense 85 1191 3 9
Genomic Location (Zv9):
Chromosome 18 (position 16992143)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17343909
GRCz11 18 17332975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCARTGKCAGACGAGGGCGAKGAAGATGAGAAAGGACTGAAGCGCTG[C/A]AYAGAAGATGAAGAGGAGGAAGAKGTGGACAGGGAAGGGGAACCCCASTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060949 Nonsense 522 1191 9 9
Genomic Location (Zv9):
Chromosome 18 (position 16932620)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17284386
GRCz11 18 17273452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGAGGAGCCACGTTCAGACTATGAAAACGATGCAAAGGAAGAAGAA[C/T]AAGTGAACAGTCCTCAAGAAAATGCTGCAGAGGCAAGCTCATCTCAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060949 Nonsense 812 1191 9 9
Genomic Location (Zv9):
Chromosome 18 (position 16931750)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17283516
GRCz11 18 17272582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCCCACCAACCAGCGCCCCCATTCTGGCAAGGCTGCCTTCCTACCC[C/T]AACCTATCCGCACACGCAAACGTAAGAAGATGTATGAGATCCACATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link