
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mrpl39
- Ensembl ID:
- ENSDARG00000041570
- ZFIN ID:
- ZDB-GENE-030131-6520
- Description:
- 39S ribosomal protein L39, mitochondrial [Source:RefSeq peptide;Acc:NP_956209]
- Human Orthologue:
- MRPL39
- Human Description:
- mitochondrial ribosomal protein L39 [Source:HGNC Symbol;Acc:14027]
- Mouse Orthologue:
- Mrpl39
- Mouse Description:
- mitochondrial ribosomal protein L39 Gene [Source:MGI Symbol;Acc:MGI:1351620]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8652 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24833 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8652
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060944 | Nonsense | 46 | 342 | 12 | 20 |
ENSDART00000147633 | Nonsense | 46 | 342 | 2 | 10 |
The following transcripts of ENSDARG00000041570 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 457036)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 587160 GRCz11 1 582339 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGTTCTGGCTCAGCGCAGTGCTCAGTTCTCCAGAGAGCAGCTCCGYCAG[C/T]GAGCGCTGCAGCCGCGGGTGGAGAAGGTGGAGGTGCAGCTGCAGGGGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24833
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060944 | Nonsense | 182 | 342 | 15 | 20 |
ENSDART00000147633 | Nonsense | 182 | 342 | 5 | 10 |
The following transcripts of ENSDARG00000041570 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 461924)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 592048 GRCz11 1 587227 - KASP Assay ID:
- 554-7610.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGGTGCTTTCTGCTGTGATCTGCTTCTGGATCCGCTTCTGGACTCCTG[G/A]AAGCCCACAGAGGTCAGAAACACCTCCTCAACACTGATTTATTCTCATCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: