ces2

Ensembl ID:
ENSDARG00000041569
ZFIN ID:
ZDB-GENE-061013-99
Description:
carboxylesterase 2-like [Source:RefSeq peptide;Acc:NP_001070720]
Human Orthologues:
CES1, CES2, CES3, CES4A, CES5A
Human Descriptions:
carboxylesterase 1 [Source:HGNC Symbol;Acc:1863]
carboxylesterase 2 [Source:HGNC Symbol;Acc:1864]
carboxylesterase 3 [Source:HGNC Symbol;Acc:1865]
carboxylesterase 4A [Source:HGNC Symbol;Acc:26741]
carboxylesterase 5A [Source:HGNC Symbol;Acc:26459]
Mouse Orthologues:
AC166833.1, Ces1a, Ces1b, Ces1c, Ces1d, Ces1e, Ces1f, Ces1g, Ces1h, Ces2a, Ces2b, Ces2c, Ces2d-ps, Ces2e, Ces2f, Ces2g, Ces3a, Ces3b, Ces4a, Ces5a, Ces5a
Mouse Descriptions:
carboxyesterase 2B Gene [Source:MGI Symbol;Acc:MGI:2448547]
carboxylesterase 1A Gene [Source:MGI Symbol;Acc:MGI:3648919]
carboxylesterase 1B Gene [Source:MGI Symbol;Acc:MGI:3779470]
carboxylesterase 1C Gene [Source:MGI Symbol;Acc:MGI:95420]
carboxylesterase 1D Gene [Source:MGI Symbol;Acc:MGI:2148202]
carboxylesterase 1E Gene [Source:MGI Symbol;Acc:MGI:95432]
carboxylesterase 1F Gene [Source:MGI Symbol;Acc:MGI:2142687]
carboxylesterase 1G Gene [Source:MGI Symbol;Acc:MGI:88378]
carboxylesterase 1H Gene [Source:MGI Symbol;Acc:MGI:1922954]
carboxylesterase 2A Gene [Source:MGI Symbol;Acc:MGI:2142491]
carboxylesterase 2C Gene [Source:MGI Symbol;Acc:MGI:2385905]
carboxylesterase 2D, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3704319]
carboxylesterase 2E Gene [Source:MGI Symbol;Acc:MGI:2443170]
carboxylesterase 2F Gene [Source:MGI Symbol;Acc:MGI:1919153]
carboxylesterase 2G Gene [Source:MGI Symbol;Acc:MGI:1919611]
carboxylesterase 3A Gene [Source:MGI Symbol;Acc:MGI:102773]
carboxylesterase 3B Gene [Source:MGI Symbol;Acc:MGI:3644960]
carboxylesterase 4A Gene [Source:MGI Symbol;Acc:MGI:2384581]
carboxylesterase 5A Gene [Source:MGI Symbol;Acc:MGI:1915185]
carboxylesterase 5A Gene [Source:MGI Symbol;Acc:MGI:1915185]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16165 Nonsense Available for shipment Available now
sa16368 Nonsense Available for shipment Available now
sa45634 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100190 Nonsense 9 555 1 13
ENSDART00000114968 Nonsense 12 552 1 14
ENSDART00000100190 Nonsense 9 555 1 13
ENSDART00000114968 Nonsense 12 552 1 14
Genomic Location (Zv9):
Chromosome 18 (position 17074709)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17426475
GRCz11 18 17415541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGTCTTTCGTGGAAAAGCAGCCATGATAAAAGACGTTTTGCTTTGCT[T/A]GTGTTTGAMACTGGCACCTGTCTGGAGCGCCCCTGTACAGGAMGGCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100190 Nonsense 9 555 1 13
ENSDART00000114968 Nonsense 12 552 1 14
ENSDART00000100190 Nonsense 9 555 1 13
ENSDART00000114968 Nonsense 12 552 1 14
Genomic Location (Zv9):
Chromosome 18 (position 17074709)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17426475
GRCz11 18 17415541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGTCTTTCGTGGAAAAGCAGCCATGATAAAAGACGTTTTGCTTTGCT[T/A]GTGTTTGAMACTGGCACCTGTCTGGAGCGCCCCTGTACAGGAMGGCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100190 Nonsense 209 555 5 13
ENSDART00000114968 Nonsense 206 552 6 14
Genomic Location (Zv9):
Chromosome 18 (position 17071854)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17423620
GRCz11 18 17412686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAGGAAACTGGGGTTTCCTCGACCAGATCGCAGCTTTACAGTGGGTG[C/T]AGCAAAACATTGAGGCTTTTGGAGGAGACCCTCAGTCTGTCACCATAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link