smg5

Ensembl ID:
ENSDARG00000041481
ZFIN ID:
ZDB-GENE-050913-144
Description:
protein SMG5 [Source:RefSeq peptide;Acc:NP_001020094]
Human Orthologue:
SMG5
Human Description:
Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) [Source:HGNC Symbol;Acc:24644]
Mouse Orthologues:
AC101827.1, Smg5
Mouse Description:
Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25030 Nonsense Mutation detected in F1 DNA During 2018
sa42810 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16480 Nonsense Available for shipment Available now
sa42811 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060809 Nonsense 276 1099 8 22
Genomic Location (Zv9):
Chromosome 16 (position 48768760)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45737981
GRCz11 16 45704697
KASP Assay ID:
554-7312.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACCACCAGGTGAAGAAACAAGAAATGAAGAAGCTTTCACCATCTCGA[C/T]AGAGGTGTGTTTCCTCTCTTATATACTTATAAAAGACCGGATGAAGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060809 Essential Splice Site 371 1099 10 22
Genomic Location (Zv9):
Chromosome 16 (position 48772476)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45741697
GRCz11 16 45708413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGGTGGTGATTTGTCTGATGGTGGTGCACAGCCTGAAGCGAGGGGG[T/C]GAGCGTGCACTGAAAGAACTGATTATGTTATTCAGTATCTGATGCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060809 Nonsense 462 1099 12 22
Genomic Location (Zv9):
Chromosome 16 (position 48774506)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45743727
GRCz11 16 45710443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAGGAGGAGGAAAAGGAGAACGGGGAAGACGAGCCTAAAGGCAAC[G/T]GAAGAACTGTGGCGACAAAGAAAAACCAGGAGAAGAAGAGATCAGCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060809 Essential Splice Site 1072 1099 21 22
Genomic Location (Zv9):
Chromosome 16 (position 48790775)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45759996
GRCz11 16 45726712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGACACTCATTAGAGGAGCTGAGTGAAAGATCGGCTTCCATGAAGG[T/A]CAGTCATGCACAAGACTCCAAGTGAGCTATTATGTAAAACGAGTTTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link