spred1

Ensembl ID:
ENSDARG00000041449
ZFIN ID:
ZDB-GENE-040426-2338
Description:
sprouty-related, EVH1 domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_998397]
Human Orthologue:
SPRED1
Human Description:
sprouty-related, EVH1 domain containing 1 [Source:HGNC Symbol;Acc:20249]
Mouse Orthologue:
Spred1
Mouse Description:
sprouty protein with EVH-1 domain 1, related sequence Gene [Source:MGI Symbol;Acc:MGI:2150016]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15659 Essential Splice Site Available for shipment Available now
sa32178 Nonsense Available for shipment Available now
sa6494 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060764 Essential Splice Site 67 391 2 6
Genomic Location (Zv9):
Chromosome 17 (position 53178994)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52564561
GRCz11 17 52650861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAYGCCGACGAGTTCCTCATCCACGGAGAACGSCTCAAAGACAAAACGG[T/G]AACATTGACGTCACAGGAAGAGCTTGATGCRGCGATGATRTCATGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060764 Nonsense 292 391 6 6
Genomic Location (Zv9):
Chromosome 17 (position 53169715)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52555282
GRCz11 17 52641582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGGCGAGCGCTCGCGGTGCATTTACTGCCGAGAGATGTTCAATCAT[G/T]AGGACAACCAGCGCGGGCAGTGCCAGGACGCGCCTGACCCCATCAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060764 Nonsense 346 391 6 6
Genomic Location (Zv9):
Chromosome 17 (position 53169553)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52555120
GRCz11 17 52641420
KASP Assay ID:
554-4597.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCRGAGGGCGACTTCTCGGATCCGTGCTCCTGCGACGCCARYGAGGAG[C/T]AGTTCTGYGTGCGCTGGCTAGCGCTGTTGGGYCTGTCTCTGCTGGCGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link