si:dkey-7c18.24

Ensembl ID:
ENSDARG00000041433
ZFIN ID:
ZDB-GENE-041014-63
Description:
hypothetical protein LOC562950 [Source:RefSeq peptide;Acc:NP_001076301]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060742 Nonsense 67 241 3 4
ENSDART00000060744   None 111 None 5

The following transcripts of ENSDARG00000041433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 46283265)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46138708
GRCz11 20 46042428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCGATGGCCAGATCCGACTCCGTGGCGCGCAACACAAGTAACAAGTCC[A/T]AGACCTCCACTGGTTCGATGGCTAGATCGGACTCAGTGGAGTGCAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link