zgc:55794

Ensembl ID:
ENSDARG00000041429
ZFIN ID:
ZDB-GENE-030131-5804
Description:
hypothetical protein LOC327593 [Source:RefSeq peptide;Acc:NP_956128]
Human Orthologue:
C15orf44
Human Description:
chromosome 15 open reading frame 44 [Source:HGNC Symbol;Acc:25372]
Mouse Orthologue:
2010321M09Rik
Mouse Description:
RIKEN cDNA 2010321M09 gene Gene [Source:MGI Symbol;Acc:MGI:1917132]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa706 Essential Splice Site Available for shipment Available now
sa36624 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060731 Essential Splice Site None 518 1 12
ENSDART00000129776 Essential Splice Site None 435 1 12
ENSDART00000135800   None 518 None 11

The following transcripts of ENSDARG00000041429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 18786543)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19016766
GRCz11 18 19005832
KASP Assay ID:
554-0614.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTACGGTGCGCNNTTGGTGAAGAAGAAGAGAGGATTTGCAGAAATGG[G/A]TAAACATTTTAACGCTTTTTNNNAAACGAAGGTTGTTATGCTTACCTWCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060731 Essential Splice Site 110 518 3 12
ENSDART00000129776 Essential Splice Site 110 435 3 12
ENSDART00000135800 Essential Splice Site 110 518 2 11

The following transcripts of ENSDARG00000041429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 18784541)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19014764
GRCz11 18 19003830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTAGTAATGTAGTACAGCAGGAGTGGGGATCTGCTTGTCCATGCCAG[G/A]TAAATCAACATACAAATATTATTTATGTAATATACATATACTATGTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link