taz

Ensembl ID:
ENSDARG00000041421
ZFIN ID:
ZDB-GENE-030131-684
Description:
tafazzin [Source:RefSeq peptide;Acc:NP_001001814]
Human Orthologue:
TAZ
Human Description:
tafazzin [Source:HGNC Symbol;Acc:11577]
Mouse Orthologue:
Taz
Mouse Description:
tafazzin Gene [Source:MGI Symbol;Acc:MGI:109626]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44993 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060718 Essential Splice Site 186 262 None 10
ENSDART00000124261 Essential Splice Site 186 262 None 11
ENSDART00000131302 Essential Splice Site None 154 None 11
ENSDART00000138805   159 158 None 6
ENSDART00000140861 Essential Splice Site 186 262 None 11
ENSDART00000147982 Essential Splice Site None 80 None 9

The following transcripts of ENSDARG00000041421 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 4974176)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4982875
GRCz11 23 4918460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAGAATGTTCTCTTCACCCAATAATTTTACCTATGTGGCATATAGG[T/C]AAGTTGTGCAGGCGCTTTTGAATGACATGACATGCAGCTATAATGCATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link