zc3h14

Ensembl ID:
ENSDARG00000041402
ZFIN ID:
ZDB-GENE-041014-257
Description:
Zinc finger CCCH domain-containing protein 14 [Source:UniProtKB/Swiss-Prot;Acc:Q5TYQ8]
Human Orthologue:
ZC3H14
Human Description:
zinc finger CCCH-type containing 14 [Source:HGNC Symbol;Acc:20509]
Mouse Orthologue:
Zc3h14
Mouse Description:
zinc finger CCCH type containing 14 Gene [Source:MGI Symbol;Acc:MGI:1919824]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15419 Essential Splice Site Available for shipment Available now
sa29458 Nonsense Mutation detected in F1 DNA During 2018
sa17062 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060695 Essential Splice Site 12 669 1 17
Genomic Location (Zv9):
Chromosome 20 (position 46743341)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46588624
GRCz11 20 46492344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCAAATAAMCATGGAGATCGGAACGGAGATTAGCAAGAAAATAAGGG[T/A]AAACCGTTTYAAATRCTTAGCACTCACCGCTTTTTAGCATGCTAGCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060695 Nonsense 203 669 6 17
Genomic Location (Zv9):
Chromosome 20 (position 46753504)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46598787
GRCz11 20 46502507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATACAGCCGTTCAACAGCAGAGAGGCAGAGACCTGCAGTGGAGTCCT[C/A]GAGACGGACAGCAGACACGTACAGATCCTCTGACATCTCCAGAGGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060695 Essential Splice Site 390 669 10 17
Genomic Location (Zv9):
Chromosome 20 (position 46760352)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46605635
GRCz11 20 46509355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGTTGGAGGTTCCAGAGGAGGACAGTCRAGAACCRCATGAATATGG[T/A]KAGATATACTGACATTKTTTWGCTTTTGACATACATTTCTRTTCAAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link