si:dkey-283b15.2

Ensembl ID:
ENSDARG00000041382
ZFIN ID:
ZDB-GENE-100921-93
Human Orthologue:
NPTX1
Human Description:
neuronal pentraxin I [Source:HGNC Symbol;Acc:7952]
Mouse Orthologue:
Nptx1
Mouse Description:
neuronal pentraxin 1 Gene [Source:MGI Symbol;Acc:MGI:107811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1033 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa1033
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060666 Nonsense 493 602 4 5
ENSDART00000132919 Nonsense 488 595 6 7
Genomic Location (Zv9):
Chromosome 16 (position 6908482)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5753013
GRCz11 16 5652639
KASP Assay ID:
554-0937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACCSCTGTCGTTGAGTGATGGTAAATGGCACCATGTGTGTGTGACGTG[G/A]TCRACGCGGGACGGTCTGTGGGAAGCCTATCAGGATGGGGTGAAGAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link