arntl2

Ensembl ID:
ENSDARG00000041381
ZFIN ID:
ZDB-GENE-000509-2
Description:
aryl hydrocarbon receptor nuclear translocator-like protein 2 [Source:RefSeq peptide;Acc:NP_571653]
Human Orthologue:
ARNTL2
Human Description:
aryl hydrocarbon receptor nuclear translocator-like 2 [Source:HGNC Symbol;Acc:18984]
Mouse Orthologue:
Arntl2
Mouse Description:
aryl hydrocarbon receptor nuclear translocator-like 2 Gene [Source:MGI Symbol;Acc:MGI:2684845]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36605 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099849 Essential Splice Site 144 631 None 17
ENSDART00000127159 Essential Splice Site 88 575 None 16

The following transcripts of ENSDARG00000041381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 15268557)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15620969
GRCz11 18 15589481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTCACTGTGCTACGAATGGCTGTCCAGCACCTCAAATCGCTCAAAGG[T/C]ACCTGTAGTGCACACCTGCTCAATATACTGGCAACAATAATTGCTTCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link