zgc:56186

Ensembl ID:
ENSDARG00000041378
ZFIN IDs:
ZDB-GENE-040426-932, ZDB-GENE-040426-932
Description:
Zgc:56186 [Source:UniProtKB/TrEMBL;Acc:Q7ZUT2]
Human Orthologue:
SH2D4A
Human Description:
SH2 domain containing 4A [Source:HGNC Symbol;Acc:26102]
Mouse Orthologue:
Sh2d4a
Mouse Description:
SH2 domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:1919531]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34834 Nonsense Available for shipment Available now
sa6159 Nonsense Mutation detected in F1 DNA During 2018
sa41587 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060663 Nonsense 146 198 3 4
ENSDART00000123312 Nonsense 146 433 3 9
Genomic Location (Zv9):
Chromosome 10 (position 6635520)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7011990
GRCz11 10 6970690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGGAGCAGGTTGTATTGTCAGATCAGGAAGTCCAGCAGAAAGCCAAA[C/T]AGGCTGAGGCTCTTCAACAGAGAAAAGCAGAGGAGGAACTCAAGGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060663 Nonsense 179 198 4 4
ENSDART00000123312 Nonsense 192 433 5 9
Genomic Location (Zv9):
Chromosome 10 (position 6632164)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7008652
GRCz11 10 6967352
KASP Assay ID:
554-4397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCAGGAGGAGAGGCGTAAGGCTGAGGAGGAGCTGAGGAGGCTGGAG[C/T]AGGAGAGRAAACAGCAGATTTACCAGTGCCTAAAGGAGGTGCAGAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060663   None 198 None 4
ENSDART00000123312 Nonsense 400 433 8 9
Genomic Location (Zv9):
Chromosome 10 (position 6620644)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6997132
GRCz11 10 6955832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGGAGACCAGATCAAATTCAGCTCCCTCAGTGAACTAGTGGAGTA[T/A]CATCAGGTAATGTGCTGTACCAACGCAATCTCACGGCAACTCGTAACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link