zgc:136564

Ensembl ID:
ENSDARG00000041372
ZFIN ID:
ZDB-GENE-070410-3
Description:
hypothetical protein LOC566166 [Source:RefSeq peptide;Acc:NP_001077027]
Human Orthologue:
C9orf64
Human Description:
chromosome 9 open reading frame 64 [Source:HGNC Symbol;Acc:28144]
Mouse Orthologue:
2210016F16Rik
Mouse Description:
RIKEN cDNA 2210016F16 gene Gene [Source:MGI Symbol;Acc:MGI:1917403]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074840 Nonsense 273 339 5 5
ENSDART00000143865   None 199 None 3
Genomic Location (Zv9):
Chromosome 8 (position 51991272)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49741659
GRCz11 8 49730428
KASP Assay ID:
554-7923.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAWCTGAATTMTTCTGTCACAGGTGAATTGTTGAGCTMGGGTGAGAGG[C/T]GAGAGGTGGAGATCAGGGGTTGCTCTATCTGGTGTGTGGAGAAGATCCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link