zgc:161969

Ensembl ID:
ENSDARG00000041359
ZFIN IDs:
ZDB-GENE-030131-2597, ZDB-GENE-030131-2597
Description:
hypothetical protein LOC569044 [Source:RefSeq peptide;Acc:NP_001077318]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33835 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109151 Essential Splice Site 56 630 1 2
ENSDART00000114667 Essential Splice Site 56 717 1 3
Genomic Location (Zv9):
Chromosome 6 (position 16386955)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16342213
GRCz11 6 16469153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTCCACCGCAAGGGACTCCACGTCTAATCTGAAGAAGCATTTAGAGG[T/C]ACTTTTGCACGTTTTCTCAAATCCATATCTAATGATTGCAGCTTTTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link