sox17

Ensembl ID:
ENSDARG00000041345
ZFIN ID:
ZDB-GENE-991213-1
Description:
SRY-box 17 [Source:RefSeq peptide;Acc:NP_571362]
Human Orthologue:
SOX17
Human Description:
SRY (sex determining region Y)-box 17 [Source:HGNC Symbol;Acc:18122]
Mouse Orthologue:
Sox17
Mouse Description:
SRY-box containing gene 17 Gene [Source:MGI Symbol;Acc:MGI:107543]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa54 Missense Available for shipment Available now
sa18408 Nonsense Available for shipment Available now
sa34220 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa54
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008864 Missense 99 413 2 2
Genomic Location (Zv9):
Chromosome 7 (position 65290203)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58471943
GRCz11 7 58774373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTATTATCAAATTTACATTGTGTCCTCTATTGTTCTGTTTATAGGTA[A/G]GTCATGGAAAGCTTTACCAATGGTGGACAAACGTCCATTCGTTGAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008864 Nonsense 120 413 2 2
Genomic Location (Zv9):
Chromosome 7 (position 65290141)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58471881
GRCz11 7 58774311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTACCAATGGTGGACAAAYGTCCATTCGYTGAGGAGGCCGAACRTCTA[C/T]GAGTCAAACATATGCAAGACCACCCAAACTACAAATATCGWCCCAGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008864 Nonsense 133 413 2 2
Genomic Location (Zv9):
Chromosome 7 (position 65290102)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58471842
GRCz11 7 58774272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAACGTCTACGAGTCAAACATATGCAAGACCACCCAAACTACAAATAT[C/T]GACCCAGGCGTCGCAAACAGGTGAAACGAAACAAGCGATTGGAGCCCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link