sox32

Ensembl ID:
ENSDARG00000041341
ZFIN ID:
ZDB-GENE-011026-1
Description:
SRY-box containing gene 32 [Source:RefSeq peptide;Acc:NP_571926]
Human Orthologue:
SOX17
Human Description:
SRY (sex determining region Y)-box 17 [Source:HGNC Symbol;Acc:18122]
Mouse Orthologue:
Sox17
Mouse Description:
SRY-box containing gene 17 Gene [Source:MGI Symbol;Acc:MGI:107543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9225 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060597 Nonsense 183 307 2 2
Genomic Location (Zv9):
Chromosome 7 (position 65341002)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58522742
GRCz11 7 58825172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAKCTCAGCTATATGTTTCAAGGTCAAGCCCCTCAGCGGCCCTACAAT[C/T]AAWTAAACTCATATAGGCTTCCCCACAATGGGTTTTCATTTGAAAACCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link