zgc:92380

Ensembl ID:
ENSDARG00000041339
ZFIN ID:
ZDB-GENE-040801-221
Description:
hypothetical protein LOC445086 [Source:RefSeq peptide;Acc:NP_001003480]
Human Orthologue:
BFSP2
Human Description:
beaded filament structural protein 2, phakinin [Source:HGNC Symbol;Acc:1041]
Mouse Orthologue:
Bfsp2
Mouse Description:
beaded filament structural protein 2, phakinin Gene [Source:MGI Symbol;Acc:MGI:1333828]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21597 Nonsense Available for shipment Available now
sa27485 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060593 Nonsense 148 384 3 7
ENSDART00000099835 Nonsense 148 501 3 8
ENSDART00000113883 Nonsense 148 426 3 9
Genomic Location (Zv9):
Chromosome 9 (position 48873500)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48318119
GRCz11 9 48015514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATATGAAGTATGCTAATGAAAAGGGTCTCGTCTGGGCAGGTTTGAGT[C/A]GGAGCAGGCCATGCGGCAAGGGGTGGAGCAAGATTTGGCACGTCTCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060593   None 384 None 7
ENSDART00000099835 Essential Splice Site 374 501 7 8
ENSDART00000113883 Essential Splice Site 374 426 7 9
Genomic Location (Zv9):
Chromosome 9 (position 48855800)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48335819
GRCz11 9 48033214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCCCCTCCATTTGTGCCACTGTCTGATGTTTTCTCTTCCCTCCCAC[A/T]GAGAGGAATTTTCTTTAGAGCAGGCCTTATATGCAGGTAAGTGCCGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link