Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mrpl15
- Ensembl ID:
- ENSDARG00000041338
- ZFIN ID:
- ZDB-GENE-040801-168
- Description:
- 39S ribosomal protein L15, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6DGM3]
- Human Orthologue:
- MRPL15
- Human Description:
- mitochondrial ribosomal protein L15 [Source:HGNC Symbol;Acc:14054]
- Mouse Orthologue:
- Mrpl15
- Mouse Description:
- mitochondrial ribosomal protein L15 Gene [Source:MGI Symbol;Acc:MGI:1351639]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa14548 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14548
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000060592 | Nonsense | 185 | 296 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 65356865)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58538605 GRCz11 7 58841035 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCGAAATGGGGGTGTTATCACAACCAGCTACTACGATCCACGGAGCCTC[C/T]GTTAGTATACTTACACTCTTAAGGCTGATTTATACTTCTGCGTCAAACAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
