wdr16

Ensembl ID:
ENSDARG00000041321
ZFIN ID:
ZDB-GENE-050522-296
Description:
WD repeat-containing protein 16 [Source:RefSeq peptide;Acc:NP_001018475]
Human Orthologue:
WDR16
Human Description:
WD repeat domain 16 [Source:HGNC Symbol;Acc:16053]
Mouse Orthologue:
Wdr16
Mouse Description:
WD repeat domain 16 Gene [Source:MGI Symbol;Acc:MGI:1919110]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40664 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15549 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060549 Essential Splice Site 438 617 11 14
Genomic Location (Zv9):
Chromosome 6 (position 18253231)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23201051
GRCz11 6 19672372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTGAAATGCAAAATTAATGTATAGCTTTGACATCTCTCTGTAATAAA[G/T]GTGAGAGTTTGGGAGATATTCCAAGACTCATATCGACTCATTGAGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060549 Nonsense 529 617 13 14
Genomic Location (Zv9):
Chromosome 6 (position 18257115)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23197167
GRCz11 6 19668488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGCAATGCAATTGTACTTATTGAACAGATTGGCTACTGGGAAGTATA[T/A]GATGGGTCTGCAATCAGAGAACTYGARGGCTCCTTGYCTGGATCTATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link