zgc:154097

Ensembl ID:
ENSDARG00000041317
ZFIN ID:
ZDB-GENE-060929-492
Description:
RAN GTPase activating protein 1 [Source:RefSeq peptide;Acc:NP_001070084]
Human Orthologue:
RANGAP1
Human Description:
Ran GTPase activating protein 1 [Source:HGNC Symbol;Acc:9854]
Mouse Orthologue:
Rangap1
Mouse Description:
RAN GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:103071]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33080 Essential Splice Site Available for shipment Available now
sa19931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088610 Essential Splice Site 38 570 2 16
Genomic Location (Zv9):
Chromosome 3 (position 5071462)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4594563
GRCz11 3 4504853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTAAGCTATAAAGGAAAGGGCCTTAAACTGGACAACGCTCAGTCTGG[T/C]GAGCTCAAACACACTGCTTTAAACACACGATTATCATCTGATGCTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088610 Nonsense 137 570 5 16
Genomic Location (Zv9):
Chromosome 3 (position 5074682)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4597783
GRCz11 3 4508073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATAACGCTTTCGGTCCAGATGGTGTAAAAGGCATCGAGAAGCTGCTC[A/T]AGAGCGCCGCCTGCCACACCCTGCAGGAACTGCGGCTCAACAACTGCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link