stx8

Ensembl ID:
ENSDARG00000041311
ZFIN ID:
ZDB-GENE-040426-1360
Description:
syntaxin-8 [Source:RefSeq peptide;Acc:NP_956669]
Human Orthologue:
STX8
Human Description:
syntaxin 8 [Source:HGNC Symbol;Acc:11443]
Mouse Orthologue:
Stx8
Mouse Description:
syntaxin 8 Gene [Source:MGI Symbol;Acc:MGI:1890156]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13970 Nonsense Available for shipment Available now
sa44633 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060547 Nonsense 180 235 6 8
ENSDART00000146442   None 54 None 2
Genomic Location (Zv9):
Chromosome 6 (position 18207481)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23246801
GRCz11 6 19718122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGTAGACAAAAACAGATGGGTCAAGAAATCGGCAATGAGCTWGATGAA[C/T]AAAACGGTGAGTGAAAAGTGCAGTAGCCTATATATGACAGGTCTGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060547 Essential Splice Site 216 235 None 8
ENSDART00000146442 Essential Splice Site 35 54 None 2
Genomic Location (Zv9):
Chromosome 6 (position 18123658)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23330624
GRCz11 6 19801945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGTGTCCTTTATTCATTAAGATGTTTTGTGTGTGTGTTTGATTTC[A/G]GGCATGATGGTGGTGATTGTTCTTCTTCTAATCGCCATCATTGTTGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link