st3gal2

Ensembl ID:
ENSDARG00000041260
ZFIN IDs:
ZDB-GENE-050419-181, ZDB-GENE-050419-181
Description:
CMP-N-acetylneuraminate-beta-galactosamide-alpha-2, 3-sialyltransferase 2 [Source:RefSeq peptide;Ac
Human Orthologue:
ST3GAL2
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 2 [Source:HGNC Symbol;Acc:10863]
Mouse Orthologue:
St3gal2
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:99427]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23280 Nonsense Available for shipment Available now
sa36622 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43080 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060483 Nonsense 136 374 1 6
ENSDART00000126032   None 398 None 6
Genomic Location (Zv9):
Chromosome 18 (position 18393606)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18623728
GRCz11 18 18612794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGGATTCGAGACAACATCCAGCTGCCTTCAGACGTGTACTACTGGT[G/A]GGTGGTAAGTGATCTTACAGTTACTCACTGATGCTTTCAGCATTACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060483 Essential Splice Site 262 374 3 6
ENSDART00000126032   None 398 None 6
Genomic Location (Zv9):
Chromosome 18 (position 18407040)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18637114
GRCz11 18 18626180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGACTTGCTGTGGATCACCAGTGCCCTCTCCACCGGACAGATCCGCTT[G/A]TAAGAACAATAACACAAACACAATTTAAACAGATTTCAATATGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060483 Nonsense 346 374 6 6
ENSDART00000126032 Nonsense 370 398 6 6
Genomic Location (Zv9):
Chromosome 18 (position 18411704)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18641927
GRCz11 18 18630993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACTGGCACCACTACTGGGAGCAGAACCGCTATTCTGGAGAGTTTCGC[A/T]AAACAGGCGTCCATGATGCCGATTACGAGGCCCAGATCATTGACAAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link