zgc:86935

Ensembl ID:
ENSDARG00000041223
ZFIN ID:
ZDB-GENE-040625-59
Description:
hypothetical protein LOC100000855 [Source:RefSeq peptide;Acc:NP_001002083]
Human Orthologue:
FAM173A
Human Description:
family with sequence similarity 173, member A [Source:HGNC Symbol;Acc:14152]
Mouse Orthologue:
Fam173a
Mouse Description:
family with sequence similarity 173, member A Gene [Source:MGI Symbol;Acc:MGI:2384888]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19964 Nonsense Available for shipment Available now
sa40017 Nonsense Mutation detected in F1 DNA During 2018
sa45135 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060426 Nonsense 24 213 3 7
ENSDART00000127738 Nonsense 24 203 4 8
ENSDART00000146053 Nonsense 24 167 2 5
Genomic Location (Zv9):
Chromosome 3 (position 14743714)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14989320
GRCz11 3 15139120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTGCTCTCAGAGTTCAGAGAGAAGCGTCTGGGCGGCTGGCAGATTT[T/A]GCAGCTGACGGCAGCAACAGGTCTGACGGTTTATGCAGTCTGGGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060426 Nonsense 64 213 4 7
ENSDART00000127738 Nonsense 64 203 5 8
ENSDART00000146053 Nonsense 64 167 3 5
Genomic Location (Zv9):
Chromosome 3 (position 14743506)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14989112
GRCz11 3 15138912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTAACCGCTACTGTTTCAGGTGCCTTACATACCAGCAAGCAAAGCT[C/T]AAGTTTCCAATGTTATGACTCTGATGAAGGGAAGGTCGGGAGGCATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060426 Nonsense 131 213 5 7
ENSDART00000127738 Nonsense 131 203 6 8
ENSDART00000146053 Nonsense 131 167 4 5
Genomic Location (Zv9):
Chromosome 3 (position 14741620)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14987226
GRCz11 3 15137026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTTTCATGCGTGGAGAGCTGGACACCATAGAAGTGTTTCTTATCGA[C/T]GAGAGGACCTCTGGAAGGTACCGTGAACATTAAAACACATAAATTTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link