zgc:123285

Ensembl ID:
ENSDARG00000041190
ZFIN ID:
ZDB-GENE-051120-57
Description:
hypothetical protein LOC641492 [Source:RefSeq peptide;Acc:NP_001032509]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10648 Essential Splice Site Available for shipment Available now
sa36212 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058637 Essential Splice Site 73 425 3 16
ENSDART00000122760 Essential Splice Site 73 474 3 16
ENSDART00000133326   None 235 None 8
ENSDART00000133689   None 238 None 7
ENSDART00000142780   None 204 None 5

The following transcripts of ENSDARG00000041190 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 39909801)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35956486
GRCz11 16 35909361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTACTTAATAGGGGACAGCAACAGAGAGCCAAGAAGCATTAGGAAAA[G/T]TAAGTCTYCAATATTATGAGTAAATAACTAAACACTATRGTGTTGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058637 Splice Site None 425 None 16
ENSDART00000122760 Splice Site None 474 None 16
ENSDART00000133326 Splice Site None 235 None 8
ENSDART00000133689 Nonsense 2 238 1 7
ENSDART00000142780   None 204 None 5

The following transcripts of ENSDARG00000041190 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 39900698)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35965589
GRCz11 16 35918464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTTTCTCAGAAGGACTAATCTGTATTTTGTTGACCATTTTTGTGAAT[C/T]AGACTGGGAATGCGGGCCAAGCACCGGTGAGAAGTGGCTCAAAGAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link