zgc:103685

Ensembl ID:
ENSDARG00000041173
ZFIN ID:
ZDB-GENE-041114-51
Description:
alpha-1B-adrenergic receptor [Source:RefSeq peptide;Acc:NP_001007359]
Human Orthologue:
ADRA1B
Human Description:
adrenergic, alpha-1B-, receptor [Source:HGNC Symbol;Acc:278]
Mouse Orthologue:
Adra1b
Mouse Description:
adrenergic receptor, alpha 1b Gene [Source:MGI Symbol;Acc:MGI:104774]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42438 Nonsense Mutation detected in F1 DNA During 2018
sa11327 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060351 Nonsense 186 481 1 2
Genomic Location (Zv9):
Chromosome 14 (position 45798489)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 43143501
GRCz11 14 43555174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTCTGGGTCCTGTCTCTGGTCATCTCTATAGGACCGCTTTTGGGTTG[G/A]AAGGAGCCTCCGTCACCGGACGACACGGTGTGCGCAATTAACGAGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060351 Essential Splice Site 317 481 2 2
Genomic Location (Zv9):
Chromosome 14 (position 45815329)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 43160341
GRCz11 14 43572014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATCATGTCATTGTAAGAAAATGTCTGATTTTTACCTTCYCTCTTCAC[A/C]GTTTCATTCAACACCAGTCTTCGGCCYCCNNAAACCGTCTYCTCCATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link