
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:103685
- Ensembl ID:
- ENSDARG00000041173
- ZFIN ID:
- ZDB-GENE-041114-51
- Description:
- alpha-1B-adrenergic receptor [Source:RefSeq peptide;Acc:NP_001007359]
- Human Orthologue:
- ADRA1B
- Human Description:
- adrenergic, alpha-1B-, receptor [Source:HGNC Symbol;Acc:278]
- Mouse Orthologue:
- Adra1b
- Mouse Description:
- adrenergic receptor, alpha 1b Gene [Source:MGI Symbol;Acc:MGI:104774]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42438 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11327 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42438
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060351 | Nonsense | 186 | 481 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 45798489)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 43143501 GRCz11 14 43555174 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAGTCTGGGTCCTGTCTCTGGTCATCTCTATAGGACCGCTTTTGGGTTG[G/A]AAGGAGCCTCCGTCACCGGACGACACGGTGTGCGCAATTAACGAGGAGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11327
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060351 | Essential Splice Site | 317 | 481 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 45815329)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 43160341 GRCz11 14 43572014 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGAATCATGTCATTGTAAGAAAATGTCTGATTTTTACCTTCYCTCTTCAC[A/C]GTTTCATTCAACACCAGTCTTCGGCCYCCNNAAACCGTCTYCTCCATCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: