hif1al

Ensembl ID:
ENSDARG00000041169
ZFIN ID:
ZDB-GENE-040426-1315
Description:
hypoxia-inducible factor 3-alpha [Source:RefSeq peptide;Acc:NP_956699]
Human Orthologue:
HIF3A
Human Description:
hypoxia inducible factor 3, alpha subunit [Source:HGNC Symbol;Acc:15825]
Mouse Orthologue:
Hif3a
Mouse Description:
hypoxia inducible factor 3, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:1859778]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45539 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18426 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023421 Essential Splice Site 283 626 8 15
ENSDART00000060343 Essential Splice Site 283 626 8 15
ENSDART00000114884   None 237 None 6
ENSDART00000124696   None 170 None 7
Genomic Location (Zv9):
Chromosome 15 (position 24841881)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25575214
GRCz11 15 25510479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGAATTATAAAAGTGGCCAATTATAGTTTTTTTTCTGTGTACTTCCA[G/A]TGTTCTCCAAGGGTCAGGTGTGTACCGGCCAGTACCGTTTTCTTGCTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023421 Essential Splice Site 562 626 13 15
ENSDART00000060343 Essential Splice Site 562 626 13 15
ENSDART00000114884   None 237 None 6
ENSDART00000124696 Essential Splice Site 106 170 5 7
Genomic Location (Zv9):
Chromosome 15 (position 24838811)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25572597
GRCz11 15 25507862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGCGGCTCGGTAGAGGACCAGCTTCTGCTCAGCCAYACATTRCTGG[T/G]AAATTCAGMTTATTTTTTNAAATGTGCAGAAGTAGGCTGTTAGTAAATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link