wdr18

Ensembl ID:
ENSDARG00000041113
ZFIN ID:
ZDB-GENE-040905-4
Description:
WD repeat-containing protein 18 [Source:RefSeq peptide;Acc:NP_001005206]
Human Orthologue:
WDR18
Human Description:
WD repeat domain 18 [Source:HGNC Symbol;Acc:17956]
Mouse Orthologue:
Wdr18
Mouse Description:
WD repeat domain 18 Gene [Source:MGI Symbol;Acc:MGI:2158400]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17072 Nonsense Available for shipment Available now
sa35048 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060251 Nonsense 74 431 2 10
Genomic Location (Zv9):
Chromosome 11 (position 13830404)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13587227
GRCz11 11 13644886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGCTCTGTGTAACATTCTGCCCCAAACTTCTTTTCAGGRCCAGCTA[C/T]AGCAGAAGATTGTGTGTCCTGGGATCGTTACAWGTCTTTGCGCGTCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060251 Essential Splice Site 199 431 4 10
Genomic Location (Zv9):
Chromosome 11 (position 13854044)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13610867
GRCz11 11 13668526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACCACAAGCTCGTGTTGCCACTGCTTCCCTGGACCAAACCGTTAAGG[T/A]GAGTTTTGGCCAGGCCCTACTAATTATGAAATGTAAAAACTGTTATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link