zgc:112432

Ensembl ID:
ENSDARG00000041085
ZFIN ID:
ZDB-GENE-050417-304
Description:
hypothetical protein LOC550477 [Source:RefSeq peptide;Acc:NP_001017780]
Human Orthologues:
C15orf38, RP11-233C13.1
Human Description:
chromosome 15 open reading frame 38 [Source:HGNC Symbol;Acc:28782]
Mouse Orthologue:
2610034B18Rik
Mouse Description:
RIKEN cDNA 2610034B18 gene Gene [Source:MGI Symbol;Acc:MGI:1917670]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9386 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100778 Nonsense 5 226 1 6
Genomic Location (Zv9):
Chromosome 18 (position 20851764)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21081987
GRCz11 18 21071053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGAGCTTTCGACGAAATCCAAATCATCGACTGAAGATGAGTCGTATTTA[T/G]GACAACACTGCGTTGTTAAAYAAACCTGTGCRCAACGAGAAACTATCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link