suv420h1

Ensembl ID:
ENSDARG00000041081
ZFIN ID:
ZDB-GENE-041114-22
Description:
Histone-lysine N-methyltransferase SUV420H1 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3H2]
Human Orthologue:
SUV420H1
Human Description:
suppressor of variegation 4-20 homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:24283]
Mouse Orthologue:
Suv420h1
Mouse Description:
suppressor of variegation 4-20 homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444557]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36641 Essential Splice Site Available for shipment Available now
sa23293 Nonsense Available for shipment Available now
sa36642 Nonsense Mutation detected in F1 DNA During 2018
sa18386 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060191 Essential Splice Site 52 808 None 10
ENSDART00000123099 Essential Splice Site 52 808 None 9
Genomic Location (Zv9):
Chromosome 18 (position 20895418)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21125641
GRCz11 18 21114707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTCGCCAGAACAAAGGCTCCCCGAGTGTCAGAAGATGCAGTCGACG[T/G]AAGTTCATAAAACAATTTATTGTATTTTACCAGTAGTTAGTTTTTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060191 Nonsense 280 808 8 10
ENSDART00000123099 Nonsense 280 808 7 9
Genomic Location (Zv9):
Chromosome 18 (position 20897442)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21127665
GRCz11 18 21116731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTGTAAAGGTTCTACGGGACATTGAACCAGGGGAAGAGATCTCCTG[C/A]TACTATGGAGATGGATTCTTTGGAGAAAACAATGAATTCTGTGAATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060191 Nonsense 366 808 9 10
ENSDART00000123099 Nonsense 366 808 8 9
Genomic Location (Zv9):
Chromosome 18 (position 20898337)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21128560
GRCz11 18 21117626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTCAGTTCCAATGCAGAGGCAGACTCTCAGGAACCAACCACTGTA[C/T]AAACATGTGAGAGACCTGTAATACCAGACGTTTGATGCTAATAATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060191 Nonsense 625 808 10 10
ENSDART00000123099 Nonsense 625 808 9 9
Genomic Location (Zv9):
Chromosome 18 (position 20899207)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21129430
GRCz11 18 21118496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTAAGAGCAGCAAGRCCCTCCGTCGAGGGAAAGGCAAGAAGAARCGA[C/T]AGATCACAYGCTATGACGCTCAGCTGATTCTGCAGAATAACTCRGGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link